Peanut Marker Database

AHGS2695 Information

Marker name AHGS2695
Marker category Genome-SSR
Primer sequences Fw GATTTGGCGATGGGAGAGTA
Rv CGACGGTAATTTTGCCCTAA
EST/Genome sequences SACT05N01
Lines
PIC Value
Lines
Map BF6 Linkage BB08
Position 20.063
BF6 Linkage BB03
Position 17.687
TF6 Linkage TB08
Position 27.278
Integrated consensus map Linkage B03
Position 55.095
Integrated consensus map Linkage B08
Position 60.811
SNP Position
Method
SSR Fragment size 238
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea