Peanut Marker Database

AHGS2685 Information

Marker name AHGS2685
Marker category Genome-SSR
Primer sequences Fw TAAACCTAGCATGGGTTGGC
Rv CATAGGTTGCAGCAGCGATA
EST/Genome sequences SAAC13E06
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 18.461
TF6 Linkage TA09
Position 82.243
Integrated consensus map Linkage B09
Position 69.64
Integrated consensus map Linkage A09
Position 30.556
SNP Position
Method
SSR Fragment size
Pattern* AC
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea