Peanut Marker Database

AHGS2680 Information

Marker name AHGS2680
Marker category Genome-SSR
Primer sequences Fw CAAGCCAACACTTGTGCATT
Rv GGAAACACAGTTGCAAGCATT
EST/Genome sequences SAAC10N07
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 109.773
BF6 Linkage BB10
Position 21.36
BF6 Linkage BB02
Position 29.989
Integrated consensus map Linkage B02
Position 48.17
Integrated consensus map Linkage B07
Position 105.385
Integrated consensus map Linkage B10
Position 62.299
SNP Position
Method
SSR Fragment size 244
Pattern* AC
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea