Peanut Marker Database

AHGS2666 Information

Marker name AHGS2666
Marker category Genome-SSR
Primer sequences Fw ATGACAGCGACATGCTATGG
Rv CACGATTATGGAGAGAGGCAG
EST/Genome sequences KICT13P03
Lines
PIC Value
Lines
Map TF6 Linkage TB10
Position 21.348
TF6 Linkage TA05
Position 43.784
TF6 Linkage TA09
Position 31.616
Integrated consensus map Linkage A05
Position 15.735
Integrated consensus map Linkage A09
Position 76.537
Integrated consensus map Linkage B10
Position 62.352
SNP Position
Method
SSR Fragment size 271
Pattern* AAG
Repeat count 7
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea