Peanut Marker Database

AHGS2648 Information

Marker name AHGS2648
Marker category Genome-SSR
Primer sequences Fw TCATCATTGTTTCTGCATTTCC
Rv CATGGCATGCATATACGGAG
EST/Genome sequences KICT12P16
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 17.813
TF6 Linkage TA06
Position 78.451
TF6 Linkage TA01
Position 45.138
Integrated consensus map Linkage A01
Position 76.409
Integrated consensus map Linkage A06
Position 78.448
SNP Position
Method
SSR Fragment size 232
Pattern* AG
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea