Peanut Marker Database

AHGS2638 Information

Marker name AHGS2638
Marker category Genome-SSR
Primer sequences Fw TGTATTGCATTCCCTCCCTC
Rv TTATGCCATGGGAAAAATGG
EST/Genome sequences KICT08E01
Lines
PIC Value
Lines
Map TF6 Linkage TA04
Position 27.711
TF6 Linkage TB04
Position 51.898
Integrated consensus map Linkage B04
Position 39.905
Integrated consensus map Linkage A04
Position 23.976
SNP Position
Method
SSR Fragment size 265
Pattern* AG
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea