Peanut Marker Database

AHGS2616 Information

Marker name AHGS2616
Marker category Genome-SSR
Primer sequences Fw AGCCAGTTAGCCACTTGGAG
Rv TTCTCCAACAAGACCAACCC
EST/Genome sequences KIAC07D18
Lines
PIC Value
Lines
Map BF6 Linkage BB06
Position 16.975
TF6 Linkage TB06
Position 20.069
TF6 Linkage TA06
Position 35.589
Integrated consensus map Linkage A06
Position 35.088
Integrated consensus map Linkage B06
Position 79.885
SNP Position
Method
SSR Fragment size 215
Pattern* AG
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea