Peanut Marker Database

AHGS2607 Information

Marker name AHGS2607
Marker category Genome-SSR
Primer sequences Fw CAAGTCAAAGAGCAGAGGCA
Rv ATCTCAGAAATGCCACCAGG
EST/Genome sequences KIAC05A22
Lines
PIC Value
Lines
Map BF6 Linkage BB07
Position 35.359
TF6 Linkage TA08
Position 5.316
Integrated consensus map Linkage B07
Position 89.975
Integrated consensus map Linkage A08
Position 10.01
SNP Position
Method
SSR Fragment size 222
Pattern* AC
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea