Peanut Marker Database

AHGS2595 Information

Marker name AHGS2595
Marker category Genome-SSR
Primer sequences Fw TTTCTGCCACTCTCACATGC
Rv CACTCAACCAATTGGGCTTT
EST/Genome sequences SACT07G06
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 38.032
BF6 Linkage BB06
Position 14.135
TF6 Linkage TB06
Position 5.327
Integrated consensus map Linkage B06
Position 88.328
Integrated consensus map Linkage A06
Position 65.198
SNP Position
Method
SSR Fragment size 115
Pattern* AG
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea