Peanut Marker Database

AHGS2594 Information

Marker name AHGS2594
Marker category Genome-SSR
Primer sequences Fw CAATCTCAGCCTTTCCTCCA
Rv TCAGTGTTCCTTGCCATTGA
EST/Genome sequences SACT07E03
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 0.0
NYF2 Linkage LG03.1
Position 78.275
TF6 Linkage TA03
Position 91.776
TF6 Linkage TA03
Position 69.892
Integrated consensus map Linkage A03
Position 110.12
Integrated consensus map Linkage A03
Position 131.607
Integrated consensus map Linkage B03
Position 87.035
SNP Position
Method
SSR Fragment size 253
Pattern* AG
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea