Peanut Marker Database

AHGS2591 Information

Marker name AHGS2591
Marker category Genome-SSR
Primer sequences Fw TGTGCTGGGACAATGATGTT
Rv CGCACAAGACTCGAAGACAA
EST/Genome sequences SACT06J14
Lines
PIC Value
Lines
Map AF5 Linkage AA08
Position 5.876
BF6 Linkage BB07
Position 35.042
Integrated consensus map Linkage B07
Position 90.422
Integrated consensus map Linkage A08
Position 19.643
SNP Position
Method
SSR Fragment size 209
Pattern* AG
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea