Peanut Marker Database

AHGS2585 Information

Marker name AHGS2585
Marker category Genome-SSR
Primer sequences Fw TCTAGATACCTACACACCCAATGAA
Rv TGCTTCTTTTGCCCGAGTAT
EST/Genome sequences SAAC13N24
Lines
PIC Value
Lines
Map BF6 Linkage BB05
Position 12.153
BF6 Linkage BB03
Position 20.244
Integrated consensus map Linkage B03
Position 57.279
Integrated consensus map Linkage B05
Position 51.311
SNP Position
Method
SSR Fragment size 104
Pattern* AC
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea