Peanut Marker Database

AHGS2554 Information

Marker name AHGS2554
Marker category Genome-SSR
Primer sequences Fw GAGGTGCACTGCATTTTGAA
Rv ACCGCCACAACGTAAGTTTC
EST/Genome sequences KICT11N18
Lines
PIC Value
Lines
Map AF5 Linkage AA09
Position 3.308
BF6 Linkage BB09
Position 41.323
Integrated consensus map Linkage B09
Position 99.371
Integrated consensus map Linkage A09
Position 69.949
SNP Position
Method
SSR Fragment size 195
Pattern* AG
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea