Marker name | AHGS2547 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | TTTTAAGCGCGCTCTCTCTC | |
Rv | AAAGCAGAACCGTGCAATCT | ||
EST/Genome sequences | KICT09F08 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA10 |
Position | 19.607 | ||
BF6 | Linkage | BB10 | |
Position | 17.932 | ||
TF6 | Linkage | TA10 | |
Position | 7.203 | ||
Integrated consensus map | Linkage | B10 | |
Position | 58.132 | ||
Integrated consensus map | Linkage | A10 | |
Position | 94.962 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 291 | |
Pattern* | AG | ||
Repeat count | 12 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.