Peanut Marker Database

AHGS2537 Information

Marker name AHGS2537
Marker category Genome-SSR
Primer sequences Fw TCAAAATTTGTGGCTCCCTC
Rv CCCCAATATCATTCCTACGG
EST/Genome sequences KICT06C20
Lines
PIC Value
Lines
Map BF6 Linkage BB05
Position 15.888
BF6 Linkage BB09
Position 20.629
BF6 Linkage BB10
Position 15.169
TF6 Linkage TA09
Position 32.981
TF6 Linkage TA09
Position 34.346
Integrated consensus map Linkage B10
Position 55.489
Integrated consensus map Linkage A09
Position 77.637
Integrated consensus map Linkage A09
Position 79.216
Integrated consensus map Linkage B05
Position 48.159
Integrated consensus map Linkage B09
Position 78.327
SNP Position
Method
SSR Fragment size 236
Pattern* AC
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea