Peanut Marker Database

AHGS2529 Information

Marker name AHGS2529
Marker category Genome-SSR
Primer sequences Fw CTCCTCCGACGAGAGAACAC
Rv TATTGATTTGTGGGTGCCAA
EST/Genome sequences KICT05E21
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 42.845
SKF2 Linkage LG09.1
Position 40.841
Integrated consensus map Linkage B09
Position 41.292
Integrated consensus map Linkage B09
Position 42.582
SNP Position
Method
SSR Fragment size 219
Pattern* AG
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea