Peanut Marker Database

AHGS2520 Information

Marker name AHGS2520
Marker category Genome-SSR
Primer sequences Fw TGAATGGCATTGCAACATTT
Rv ATGTCACATATGCCCCCTGT
EST/Genome sequences KIAC13F21
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 11.287
TF6 Linkage TB03
Position 71.942
TF6 Linkage TA04
Position 19.33
Integrated consensus map Linkage A04
Position 17.868
Integrated consensus map Linkage B03
Position 61.084
SNP Position
Method
SSR Fragment size 173
Pattern* AT
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea