Peanut Marker Database

AHGS2509 Information

Marker name AHGS2509
Marker category Genome-SSR
Primer sequences Fw GTTAATCCCGCCTACGTTCA
Rv CACATTCCCTTAAGATGTCGC
EST/Genome sequences KIAC07K06
Lines
PIC Value
Lines
Map BF6 Linkage BB05
Position 15.737
TF6 Linkage TB05
Position 28.726
TF6 Linkage TB10
Position 20.215
TF6 Linkage TA05
Position 24.075
Integrated consensus map Linkage A05
Position 50.483
Integrated consensus map Linkage B05
Position 50.834
Integrated consensus map Linkage B10
Position 60.484
SNP Position
Method
SSR Fragment size 182
Pattern* AC
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea