Peanut Marker Database

AHGS2496 Information

Marker name AHGS2496
Marker category Genome-SSR
Primer sequences Fw CACTGCGAAATCGCTAAACA
Rv TGCAGATCTCAGTGAAACCG
EST/Genome sequences SACT14A03
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 15.098
TF6 Linkage TA09
Position 35.153
Integrated consensus map Linkage B09
Position 71.975
Integrated consensus map Linkage A09
Position 80.224
SNP Position
Method
SSR Fragment size 267
Pattern* AG
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea