Peanut Marker Database

AHGS2495 Information

Marker name AHGS2495
Marker category Genome-SSR
Primer sequences Fw CACGTCACATCACACAGCAG
Rv GTTGCCGTTGGAAACAGTCT
EST/Genome sequences SACT13N09
Lines
PIC Value
Lines
Map NYF2 Linkage LG09.2
Position 0.0
AF5 Linkage AA04
Position 39.851
BF6 Linkage BB09
Position 27.064
TF6 Linkage TA09
Position 46.581
Integrated consensus map Linkage A09
Position 67.173
Integrated consensus map Linkage B09
Position 84.416
Integrated consensus map Linkage A04
Position 48.281
SNP Position
Method
SSR Fragment size 282
Pattern* AG
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea