Peanut Marker Database

AHGS2493 Information

Marker name AHGS2493
Marker category Genome-SSR
Primer sequences Fw CATAGGTTGCAGCAGCGATA
Rv TAAACCTAGCATGGGTTGGC
EST/Genome sequences SACT13D22
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 17.78
TF6 Linkage TA09
Position 81.61
Integrated consensus map Linkage B09
Position 72.749
Integrated consensus map Linkage A09
Position 30.994
SNP Position
Method
SSR Fragment size 285
Pattern* AG
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea