| Marker name | AHGS2466 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TTGGATTGGAATGCTGACAA | |
| Rv | GAAAGGGATTGCCTCTCAAG | ||
| EST/Genome sequences | SAAC13E16 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | SKF2 | Linkage | LG01.2 |
| Position | 50.421 | ||
| AF5 | Linkage | AA01 | |
| Position | 19.881 | ||
| AF5 | Linkage | AA03 | |
| Position | 23.903 | ||
| TF6 | Linkage | TA01 | |
| Position | 44.986 | ||
| TF6 | Linkage | TA04 | |
| Position | 79.233 | ||
| TF6 | Linkage | TB01 | |
| Position | 35.871 | ||
| Integrated consensus map | Linkage | A01 | |
| Position | 77.487 | ||
| Integrated consensus map | Linkage | A03 | |
| Position | 88.162 | ||
| Integrated consensus map | Linkage | A04 | |
| Position | 72.256 | ||
| Integrated consensus map | Linkage | B01 | |
| Position | 31.545 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 196 | |
| Pattern* | AC | ||
| Repeat count | 12 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.