Peanut Marker Database

AHGS2466 Information

Marker name AHGS2466
Marker category Genome-SSR
Primer sequences Fw TTGGATTGGAATGCTGACAA
Rv GAAAGGGATTGCCTCTCAAG
EST/Genome sequences SAAC13E16
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.2
Position 50.421
AF5 Linkage AA01
Position 19.881
AF5 Linkage AA03
Position 23.903
TF6 Linkage TA01
Position 44.986
TF6 Linkage TA04
Position 79.233
TF6 Linkage TB01
Position 35.871
Integrated consensus map Linkage A03
Position 88.162
Integrated consensus map Linkage A04
Position 72.256
Integrated consensus map Linkage B01
Position 31.545
Integrated consensus map Linkage A01
Position 77.487
SNP Position
Method
SSR Fragment size 196
Pattern* AC
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea