Peanut Marker Database

AHGS2443 Information

Marker name AHGS2443
Marker category Genome-SSR
Primer sequences Fw CAAATGACGAAAAGCAATAATTAGAA
Rv CTAACCCTAAGCCACCCACA
EST/Genome sequences KICT13J23
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 38.805
TF6 Linkage TB05
Position 63.156
TF6 Linkage TB10
Position 19.114
TF6 Linkage TB02
Position 18.971
Integrated consensus map Linkage A06
Position 66.314
Integrated consensus map Linkage B02
Position 65.545
Integrated consensus map Linkage B05
Position 98.919
Integrated consensus map Linkage B10
Position 60.654
SNP Position
Method
SSR Fragment size 166
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea