| Marker name | AHGS2443 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | CAAATGACGAAAAGCAATAATTAGAA | |
| Rv | CTAACCCTAAGCCACCCACA | ||
| EST/Genome sequences | KICT13J23 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | AF5 | Linkage | AA06 |
| Position | 38.805 | ||
| TF6 | Linkage | TB02 | |
| Position | 18.971 | ||
| TF6 | Linkage | TB05 | |
| Position | 63.156 | ||
| TF6 | Linkage | TB10 | |
| Position | 19.114 | ||
| Integrated consensus map | Linkage | A06 | |
| Position | 66.314 | ||
| Integrated consensus map | Linkage | B02 | |
| Position | 65.545 | ||
| Integrated consensus map | Linkage | B05 | |
| Position | 98.919 | ||
| Integrated consensus map | Linkage | B10 | |
| Position | 60.654 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 166 | |
| Pattern* | AG | ||
| Repeat count | 13 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.