Peanut Marker Database

AHGS2440 Information

Marker name AHGS2440
Marker category Genome-SSR
Primer sequences Fw CCGATAAATCCGACGGTAAA
Rv GATAAAAGGCGGCAATGAAA
EST/Genome sequences KICT09F01
Lines
PIC Value
Lines
Map AF5 Linkage AA07
Position 10.293
BF6 Linkage BB07
Position 35.675
Integrated consensus map Linkage B07
Position 89.331
Integrated consensus map Linkage A07
Position 70.074
SNP Position
Method
SSR Fragment size
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea