Peanut Marker Database

AHGS2437 Information

Marker name AHGS2437
Marker category Genome-SSR
Primer sequences Fw GAAGAAGCGATAAGGGGGTC
Rv AAAGCCAAGCAAGCCACTAA
EST/Genome sequences KICT09G15
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 73.043
TF6 Linkage TA01
Position 77.58
Integrated consensus map Linkage B10
Position 27.003
Integrated consensus map Linkage A01
Position 105.007
SNP Position
Method
SSR Fragment size 289
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea