Peanut Marker Database

AHGS2434 Information

Marker name AHGS2434
Marker category Genome-SSR
Primer sequences Fw AGGGGACTGCTATCGGAAAT
Rv ATTTGAGTCGGGAACCCTCT
EST/Genome sequences KICT08A17
Lines
PIC Value
Lines
Map TF6 Linkage TA10
Position 9.83
TF6 Linkage TA03
Position 47.282
Integrated consensus map Linkage A03
Position 88.58
Integrated consensus map Linkage A10
Position 94.028
SNP Position
Method
SSR Fragment size 206
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea