Peanut Marker Database

AHGS2395 Information

Marker name AHGS2395
Marker category Genome-SSR
Primer sequences Fw TGAGAATCTTGGAAAAGCCG
Rv AACTATAGAAGCGGACAGGGC
EST/Genome sequences SACT10F05
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 44.543
TF6 Linkage TA05
Position 23.793
TF6 Linkage TA09
Position 57.89
Integrated consensus map Linkage A09
Position 55.882
Integrated consensus map Linkage B05
Position 51.014
Integrated consensus map Linkage A05
Position 49.724
SNP Position
Method
SSR Fragment size 116
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea