Peanut Marker Database

AHGS2393 Information

Marker name AHGS2393
Marker category Genome-SSR
Primer sequences Fw ATTTCCACCATTTGAACCCA
Rv TGCAAGAGCAGAAACAAGGA
EST/Genome sequences SACT10M16
Lines
PIC Value
Lines
Map TF6 Linkage TA04
Position 10.931
TF6 Linkage TB04
Position 38.644
Integrated consensus map Linkage B04
Position 12.748
Integrated consensus map Linkage A04
Position 10.475
SNP Position
Method
SSR Fragment size 192
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea