Peanut Marker Database

AHGS2379 Information

Marker name AHGS2379
Marker category Genome-SSR
Primer sequences Fw CATCGTCAGAGGAGTGACCA
Rv AAAGCCCTTCTCCCTCACAT
EST/Genome sequences SACT05H09
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.2
Position 41.308
TF6 Linkage TB01
Position 36.054
TF6 Linkage TA03
Position 51.874
Integrated consensus map Linkage A03
Position 91.333
Integrated consensus map Linkage B01
Position 40.195
SNP Position
Method
SSR Fragment size 97
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea