Peanut Marker Database

AHGS2377 Information

Marker name AHGS2377
Marker category Genome-SSR
Primer sequences Fw GATAAAAGGCGGCAATGAAA
Rv CCGATAAATCCGACGGTAAA
EST/Genome sequences SACT05L19
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 84.683
AF5 Linkage AA09
Position 14.05
BF6 Linkage BB07
Position 35.617
TF6 Linkage TB07
Position 27.684
Integrated consensus map Linkage B07
Position 88.291
Integrated consensus map Linkage A09
Position 79.705
SNP Position
Method
SSR Fragment size 254
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea