Peanut Marker Database

AHGS2373 Information

Marker name AHGS2373
Marker category Genome-SSR
Primer sequences Fw CTCACACTGACTGGCCACAT
Rv CCTTAACACAGCATCACGAGTT
EST/Genome sequences SACT06N24
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.2
Position 52.89
AF5 Linkage AA04
Position 41.314
BF6 Linkage BB04
Position 22.283
TF6 Linkage TA04
Position 56.759
Integrated consensus map Linkage B04
Position 65.3
Integrated consensus map Linkage A04
Position 52.281
SNP Position
Method
SSR Fragment size 299
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea