Peanut Marker Database

AHGS2353 Information

Marker name AHGS2353
Marker category Genome-SSR
Primer sequences Fw GTTCAGGTCAGGCCAATGAT
Rv ACACAAAAAGGCAATCCCAG
EST/Genome sequences SAAC09K19
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.2
Position 4.277
AF5 Linkage AA03
Position 22.933
AF5 Linkage AA05
Position 54.012
AF5 Linkage AA03
Position 12.751
TF6 Linkage TA01
Position 43.951
TF6 Linkage TA03
Position 40.622
TF6 Linkage TA03
Position 40.622
Integrated consensus map Linkage A03
Position 77.138
Integrated consensus map Linkage A03
Position 81.462
Integrated consensus map Linkage A05
Position 53.319
Integrated consensus map Linkage A01
Position 80.173
Integrated consensus map Linkage A03
Position 22.597
SNP Position
Method
SSR Fragment size 287
Pattern* AC
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea