Peanut Marker Database

AHGS2351 Information

Marker name AHGS2351
Marker category Genome-SSR
Primer sequences Fw GCACGAGAAAAGTGAAAGCC
Rv TTCTTCTTCCTCTCCTCCCC
EST/Genome sequences SAAC06P19
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.2
Position 0.0
AF5 Linkage AA09
Position 13.891
AF5 Linkage AA04
Position 38.625
BF6 Linkage BB06
Position 14.723
Integrated consensus map Linkage A04
Position 39.049
Integrated consensus map Linkage A09
Position 80.273
Integrated consensus map Linkage B06
Position 84.093
SNP Position
Method
SSR Fragment size 262
Pattern* AC
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea