Peanut Marker Database

AHGS2335 Information

Marker name AHGS2335
Marker category Genome-SSR
Primer sequences Fw CCTTAGGGACATTTCGGTCA
Rv CGAGGTATTGGACGATACGG
EST/Genome sequences KICT11O18
Lines
PIC Value
Lines
Map SKF2 Linkage LG10.2(t)
Position 6.549
TF6 Linkage TA06
Position 104.994
TF6 Linkage TA06
Position 83.617
Integrated consensus map Linkage A06
Position 84.017
Integrated consensus map Linkage A06
Position 94.198
Integrated consensus map Linkage A06
Position 104.887
SNP Position
Method
SSR Fragment size 290
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea