Peanut Marker Database

AHGS2333 Information

Marker name AHGS2333
Marker category Genome-SSR
Primer sequences Fw AGAGGGTTTCACAGCATTGG
Rv CACCTCCTTCTCCTTCTCCTC
EST/Genome sequences KICT12M21
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 50.603
SKF2 Linkage LG09.2
Position 69.534
TF6 Linkage TB09
Position 21.99
TF6 Linkage TA09
Position 33.813
Integrated consensus map Linkage A09
Position 73.759
Integrated consensus map Linkage B09
Position 60.255
SNP Position
Method
SSR Fragment size 153
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea