Peanut Marker Database

AHGS2330 Information

Marker name AHGS2330
Marker category Genome-SSR
Primer sequences Fw ACTAACCGCGAGATGAGAGC
Rv AAAGCTAAAGCGAAACGACG
EST/Genome sequences KICT09J22
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 21.786
BF6 Linkage BB05
Position 42.558
Integrated consensus map Linkage B05
Position 79.665
Integrated consensus map Linkage A05
Position 27.083
SNP Position
Method
SSR Fragment size 194
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea