Peanut Marker Database

AHGS2327 Information

Marker name AHGS2327
Marker category Genome-SSR
Primer sequences Fw TTGCAGAGGGTTTGAAGCTC
Rv GAACCCTCGCATATTCTCCA
EST/Genome sequences KICT09M20
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 39.05
TF6 Linkage TB03
Position 63.156
TF6 Linkage TA03
Position 31.084
Integrated consensus map Linkage A03
Position 71.181
Integrated consensus map Linkage B03
Position 74.316
SNP Position
Method
SSR Fragment size 280
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea