Peanut Marker Database

AHGS2324 Information

Marker name AHGS2324
Marker category Genome-SSR
Primer sequences Fw GTGCGAGGGTGAGAGGTTAG
Rv GTCGCCGGTAACTTTTGGTA
EST/Genome sequences KICT06P10
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 47.325
TF6 Linkage TB06
Position 19.872
TF6 Linkage TB09
Position 25.347
Integrated consensus map Linkage B09
Position 58.701
Integrated consensus map Linkage B06
Position 77.509
SNP Position
Method
SSR Fragment size 284
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea