Peanut Marker Database

AHGS2323 Information

Marker name AHGS2323
Marker category Genome-SSR
Primer sequences Fw CTTTTTGGTCTTCCAAACGC
Rv CACTTGTGTTCCCCACCTTT
EST/Genome sequences KICT08A03
Lines
PIC Value
Lines
Map AF5 Linkage AA03
Position 30.265
BF6 Linkage BB03
Position 23.602
TF6 Linkage TA03
Position 61.217
TF6 Linkage TA03
Position 98.908
Integrated consensus map Linkage A03
Position 100.372
Integrated consensus map Linkage A03
Position 140.918
Integrated consensus map Linkage B03
Position 60.8
Integrated consensus map Linkage A03
Position 94.647
SNP Position
Method
SSR Fragment size 148
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea