Peanut Marker Database

AHGS2320 Information

Marker name AHGS2320
Marker category Genome-SSR
Primer sequences Fw GTCAAAACCTTGCTTCCACC
Rv ATTTTTCTTCCTCCCTCCCC
EST/Genome sequences KICT08D05
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 18.875
TF6 Linkage TA09
Position 76.405
Integrated consensus map Linkage B09
Position 75.211
Integrated consensus map Linkage A09
Position 35.877
SNP Position
Method
SSR Fragment size 288
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea