Peanut Marker Database

AHGS2319 Information

Marker name AHGS2319
Marker category Genome-SSR
Primer sequences Fw GTGGTGAGAAGAAGAAGCGG
Rv CAACGGTAACTGTGCCGTAA
EST/Genome sequences KICT06D16
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.1
Position 93.041
BF6 Linkage BB04
Position 25.869
TF6 Linkage TA08
Position 38.53
TF6 Linkage TA05
Position 39.438
Integrated consensus map Linkage A05
Position 20.267
Integrated consensus map Linkage A08
Position 49.59
Integrated consensus map Linkage B04
Position 67.516
SNP Position
Method
SSR Fragment size 232
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea