Peanut Marker Database

AHGS2299 Information

Marker name AHGS2299
Marker category Genome-SSR
Primer sequences Fw GTCCAAAGCCCAATGTCTTG
Rv GCTGTCAAACGGTCAAACCT
EST/Genome sequences SACT13O07
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 33.678
NYF2 Linkage LG03.1
Position 66.53
TF6 Linkage TA03
Position 80.768
TF6 Linkage TA03
Position 69.327
Integrated consensus map Linkage A03
Position 109.148
Integrated consensus map Linkage A03
Position 118.145
Integrated consensus map Linkage B03
Position 77.127
SNP Position
Method
SSR Fragment size 208
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea