Peanut Marker Database

AHGS2297 Information

Marker name AHGS2297
Marker category Genome-SSR
Primer sequences Fw TTCACAAAGATCAGCATTAGCA
Rv GTTGAGGAGCTTCTTGACCG
EST/Genome sequences SACT14O10
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.1
Position 26.127
AF5 Linkage AA03
Position 3.899
AF5 Linkage AA06
Position 35.572
BF6 Linkage BB10
Position 23.341
TF6 Linkage TA06
Position 56.85
TF6 Linkage TA10
Position 8.91
Integrated consensus map Linkage B10
Position 63.792
Integrated consensus map Linkage A03
Position 66.563
Integrated consensus map Linkage A06
Position 61.527
Integrated consensus map Linkage A10
Position 93.592
SNP Position
Method
SSR Fragment size 266
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea