Marker name | AHGS2297 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | TTCACAAAGATCAGCATTAGCA | |
Rv | GTTGAGGAGCTTCTTGACCG | ||
EST/Genome sequences | SACT14O10 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG06.1 |
Position | 26.127 | ||
AF5 | Linkage | AA03 | |
Position | 3.899 | ||
AF5 | Linkage | AA06 | |
Position | 35.572 | ||
BF6 | Linkage | BB10 | |
Position | 23.341 | ||
TF6 | Linkage | TA06 | |
Position | 56.85 | ||
TF6 | Linkage | TA10 | |
Position | 8.91 | ||
Integrated consensus map | Linkage | A10 | |
Position | 93.592 | ||
Integrated consensus map | Linkage | B10 | |
Position | 63.792 | ||
Integrated consensus map | Linkage | A03 | |
Position | 66.563 | ||
Integrated consensus map | Linkage | A06 | |
Position | 61.527 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 266 | |
Pattern* | AG | ||
Repeat count | 14 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.