Peanut Marker Database

AHGS2249 Information

Marker name AHGS2249
Marker category Genome-SSR
Primer sequences Fw GTTGTGGTGACGAGCTCAAA
Rv CCACTAACCACCCCATCATC
EST/Genome sequences KICT10N09
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.2
Position 23.858
NYF2 Linkage LG08.2
Position 0.0
BF6 Linkage BB08
Position 17.265
BF6 Linkage BB08
Position 25.827
Integrated consensus map Linkage B08
Position 59.099
Integrated consensus map Linkage B08
Position 73.56
Integrated consensus map Linkage B08
Position 26.163
SNP Position
Method
SSR Fragment size 109
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea