Peanut Marker Database

AHGS2245 Information

Marker name AHGS2245
Marker category Genome-SSR
Primer sequences Fw CACGACCACCCATATAACCC
Rv TTAGTGAAGTGATCGCGTGG
EST/Genome sequences KICT10I20
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.2
Position 16.227
BF6 Linkage BB03
Position 4.892
Integrated consensus map Linkage B03
Position 36.085
Integrated consensus map Linkage B01
Position 20.939
SNP Position
Method
SSR Fragment size 204
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea