Peanut Marker Database

AHGS2243 Information

Marker name AHGS2243
Marker category Genome-SSR
Primer sequences Fw TACCGCAGGCGTAGATTTTC
Rv GTCGTCGTCCATATCGCTTT
EST/Genome sequences KICT10P21
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.2
Position 0.0
NYF2 Linkage LG06.2
Position 34.179
TF6 Linkage TA04
Position 22.52
TF6 Linkage TA06
Position 58.168
TF6 Linkage TA06
Position 59.079
TF6 Linkage TB06
Position 41.819
Integrated consensus map Linkage A06
Position 58.678
Integrated consensus map Linkage B06
Position 39.007
Integrated consensus map Linkage A04
Position 20.127
Integrated consensus map Linkage A06
Position 58.288
SNP Position
Method
SSR Fragment size 294
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea