Peanut Marker Database

AHGS2241 Information

Marker name AHGS2241
Marker category Genome-SSR
Primer sequences Fw CACATGGAAATGCAAATGGA
Rv AGCGTGTCGTGCTTTCTTCT
EST/Genome sequences KICT08H01
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 76.999
BF6 Linkage BB05
Position 21.828
TF6 Linkage TB05
Position 47.078
TF6 Linkage TA05
Position 24.693
Integrated consensus map Linkage A05
Position 49.312
Integrated consensus map Linkage B05
Position 60.225
SNP Position
Method
SSR Fragment size 173
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea