Peanut Marker Database

AHGS2237 Information

Marker name AHGS2237
Marker category Genome-SSR
Primer sequences Fw ACAACTAGGCTTGCCGAGAA
Rv CTCTCTCACAACCTCTGCCC
EST/Genome sequences KICT08L14
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.1
Position 39.822
AF5 Linkage AA10
Position 24.913
AF5 Linkage AA01
Position 21.082
TF6 Linkage TA10
Position 10.513
Integrated consensus map Linkage A01
Position 78.012
Integrated consensus map Linkage A10
Position 87.517
SNP Position
Method
SSR Fragment size 108
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea