Peanut Marker Database

AHGS2228 Information

Marker name AHGS2228
Marker category Genome-SSR
Primer sequences Fw TCAAGCATTGCCAAACTGAC
Rv CGCCTATGAATCATGAGCAA
EST/Genome sequences KIAC14J07
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 107.264
BF6 Linkage BB01
Position 15.727
BF6 Linkage BB03
Position 19.303
BF6 Linkage BB05
Position 26.858
BF6 Linkage BB06
Position 16.251
TF6 Linkage TB03
Position 37.394
TF6 Linkage TB05
Position 55.176
Integrated consensus map Linkage B01
Position 45.579
Integrated consensus map Linkage B03
Position 54.128
Integrated consensus map Linkage B05
Position 69.129
Integrated consensus map Linkage B06
Position 84.67
SNP Position
Method
SSR Fragment size 171
Pattern* AC
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea