Peanut Marker Database

AHGS2221 Information

Marker name AHGS2221
Marker category Genome-SSR
Primer sequences Fw TGAAGGAGAGATCATCGCAA
Rv CAGCACCTAAACAGCCATCA
EST/Genome sequences KIAC11P19
Lines
PIC Value
Lines
Map BF6 Linkage BB07
Position 5.976
TF6 Linkage TA07
Position 13.007
Integrated consensus map Linkage B07
Position 57.022
Integrated consensus map Linkage A07
Position 45.74
SNP Position
Method
SSR Fragment size 290
Pattern* AC
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea